This document outlines the laboratory procedure for identifying the clade of Zooxanthellae (symbiotic algae, primarily Symbiodiniaceae) associated with coral tissue. The protocol involves gDNA extraction using the ISOLATE II Plant DNA Kit, followed by PCR amplification of the ITS2 region, and visualization via Agarose Gel Electrophoresis.

---

A. gDNA Extraction with ISOLATE II Plant DNA Kit

The ISOLATE II Plant DNA Kit is designed for rapid purification of genomic DNA (gDNA) from plant material.

🧪 Kit Features

• Target: Plant genomic DNA.
• Isolation Time: ~30 minutes.
• Purity: High-purity DNA (typical 260/280 ratio 1.6 to 1.9).
• Lysis Systems: Contains optimized CTAB and SDS lysis buffers.
• Components: Includes RNase A to remove RNA.
• Downstream Applications: Suitable for PCR, qPCR, cloning, and NGS.
• Link: ISOLATE II Plant DNA Kit Guide

🔬 Plant DNA Isolation Procedure

1. Pre-heat incubator to 65 ºC.
2. Fill a bucket with ice.

Initial steps for Tissue Samples

1. Add 0.25mm glass beads to an empty sterile Eppendorf tube.
2. Use a blade razer and cut 25 mm of a coral tissue sample.
3. Vortex at max speed for 2 min.
4. Transfer 400 µl of the supernatant to a clean tube.
5. Centrifuge at 9,000 x g for 3 min.
6. Transfer 300 µl of the supernatant to a clean tube, and discard the pellet.

Initial steps for Samples Stored in Acetone

1. Centrifuge at max speed for 1 min.
2. Remove acetone.
3. Repeat centrifuge step to remove acetone remains.
4. Use a filter tip to remove remaining acetone.
5. Wash pellet in 1 ml FSW (0.22µ filtered sea water) or PBS.
6. Mix pellet with FSW or PBS.
7. Centrifuge again.
8. If a pellet does not form, add another centrifugation step: 5 min at max speed.
9. Remove FSW supernatant using a filter tip, taking care not to disturb the pellet.

   Note: If some FSW remains, continue without trying to remove it.

Lysis

1. Add 15 µl Proteinase K + 30 µl PK digestion buffer (from Zymo kit - not included).
2. Incubate for 30 min at RT (Room Temperature).
3. Vortex.
4. Spin down.
5. Centrifuge at max speed for 2 min.
6. Add 400 µl Lysis Buffer PA1 (Pre-heated to 65 ºC).
7. Incubate for 25 min at 65 ºC.

Filter Crude Lysate

1. Transfer lysate to a collection tube with a purple filter column.
2. Centrifuge 11,000 x g, 2 min.
3. Collect supernatant to a new tube, discard the pellet.
4. Add 450 µL Binding Buffer PB.
5. Pipette 5 times up and down to mix.

Bind DNA

1. Load lysate onto a collection tube with a green filter column (up to 700 µl).
2. Centrifuge 11,000 x g, 1 min.
3. Discard the flow-through.

Wash and Dry Silica Membrane

1. 1st wash: Add 400 µL Wash Buffer PAW1.
2. Centrifuge 11,000 x g, 1 min.
3. Discard the flow-through.
4. 2nd wash: Add 700 µL Wash Buffer PAW2.
5. Centrifuge 11,000 x g, 1 min.
6. Discard the flow-through.
7. 3rd wash: Add 200 µL Wash Buffer PAW2.
8. Centrifuge 11,000 x g, 2 min.
9. Discard the flow-through and collection tube.

Elute DNA

1. Place the green filter column in an empty sterile eppendorf tube.
2. Add 50 µL Elution Buffer PG (Pre-heat to 65ºC).
3. Incubate 65ºC, 5 min.
4. Centrifuge 11,000 x g, 1 min.
5. Repeat DNA elution step (This yields the isolated DNA).
6. Measure DNA quantity and ratio with NanoDrop.

---

B. Polymerase Chain Reaction (PCR)

🧬 Primers for ITS2 Amplification

The following primers are used to amplify the Internal Transcribed Spacer 2 (ITS2) region, a standard marker for Symbiodiniaceae identification.

Primer Name	Type	Sequence (5’ to 3’)
CS1F	F (Forward)	ACACTGACGACATGGTTCTACATGTGAATTGCAGAACTCCGTG
CS2R	R (Reverse)	TACGGTAGCAGAGACTTGGTCTTACTTATATGCTTAAATTCRGCGG

🧪 PCR Reaction Mix (GoTaq® Green Master Mix)

This is the setup for a 50 µl reaction volume in a 0.2 ml PCR tube.

Component	Volume	Final Concentration
GoTaq® Green Master Mix, 2X	25 µl	1X
upstream primer (CS1F), 10µM	5.0 µl	1.0 µM
downstream primer (CS2R), 10µM	5.0 µl	1.0 µM
DNA template	10.0 µl	e.g., 52 ng, 55 ng, or 0.46 ng
BSA	5.0 µl	-
H₂O (Nuclease-free)	-	(Volume to bring total to 50 µl)

🌡️ PCR Program (ITS CS - 16/_NGS)

The program is run on a BioRad C1000 Touch Thermal Cycler.

Cycles	Time	Temp (°C)	Step
1	45 sec	94	Initial Denaturation
10	15 sec	94	Denaturation
	15 sec	50	Annealing
	30 sec	72	Elongation
15	15 sec	94	Denaturation
	15 sec	60	Annealing
	30 sec	72	Elongation
1	2 min	72	Final Extension

---

C. Agarose Gel Electrophoresis (1% Gel)

🔬 Gel Preparation

1. Weigh 1 g of agarose.
2. Add 100 ml of 0.5X TBE buffer.
3. Microwave for 1 min to dissolve the agarose fully.
4. Chill with tap water.
5. Add 4 µl of Red Safe (DNA stain).
6. Pour the mixture into the gel formation device with a proper comb.
7. Wait 45 min for the gel to solidify.

⚡ Electrophoresis Setup

1. Fill the running device tanks with used 0.5X TBE buffer.
2. Place the gel in the device and ensure the wells are submerged/filled with buffer.
3. Load 2 µl of EuRx Perfect 100bp DNA ladder (100bp-2500bp) 2 µl of 1 kb DNA ladder.
4. Load 5 µl of the PCR product sample into the wells.
5. Plug in the wires.
6. Set running time to 75 minutes and voltage to 110 V (10 V of cm gel).